Prevalence of ST171 in Enterobacter Isolates from 2001 to 2013 in 15 Hospitals in NYC. (4th October 2017)

• Record Type: Journal Article
• Authors: Benjamin, Carla; Eilertson, Brandon
• Is Part Of: Open forum infectious diseases. Volume 4(2017)Supplement 1
• Page Start: S230
• Page End: S230
• Publication Date: 2017-10-04
• Subjects: Communicable diseases -- Periodicals; Medical microbiology -- Periodicals; Infection -- Periodicals; 616.9
• DOI: 10.1093/ofid/ofx163.480
• Languages: English
• ISSNs: 2328-8957

Abstract

Abstract: Background: ST171 was identified as the most prevalent ST in carbapenem-resistant Enterobacter in 26/106 typed isolates from New York City by Gomez-Simmonds et al. There is no study of prevalence of this ST over time. To evaluate a large sample of Enterobacter, we designed a PCR assay to identify ST171 isolates rapidly. Methods: Isolates were collected in NYC as part of a cross-sectional Gram-negative antibiotic resistance assessment in the years, 2001, 2003–2004, 2006, 2009, and 2013. Agar dilution MIC were obtained for all isolates as part of these studies. We assayed 284 clinical Enterobacter isolates for ST171 using a novel PCR assay, forward primer AGAAGGACGATTTTGGCGCGGT and reverse ACTACGGTGGTAAAGAATGATCGCCA. Following amplification, ST171 positive isolates were identified by gel electrophoresis. Enterobacter isolates were also assessed for the presence of bla KPC using a previously described RT-PCR assay. Results: ST171 was identified in 17/284 (6%) Enterobacter isolates. This sample collection was heavily antibiotic-resistant with 83/284 Enterobacter isolates harboring bla KPC. Of the 284 isolates, 142 (50%) were resistant to any carbapenem and 113 (40%) were resistant to ceftazidime. Of 17 ST171 positive Enterobacter isolates, 14(82%) were also contained bla KPC . These isolates were highly resistant, with 10/17(59%) exhibiting phenotypic resistance to carbapenems and 14/17(82%) were phenotypically resistant to ceftazidime. Twelve of the 17 isolates occurred in clusters of isolates of the same species occurring in a single hospital at the same time. There were 2 clusters of 3 cases and 3 clusters of 2 patients each. The oldest ST171 strain identified was an Enterobacter cloacae isolate collected in 2001. Prevalence of ST171 was calculated for each year of data: 1/40(2.5%) in 2001, 0/20 in 2003-04, 7/73(9.6%) in 2006, 6/38(15.8%) in 2009, and 3/113(2.7%) in 2013. Each sample collection year included a different group of participating hospitals. Conclusion: Here we evaluate a novel PCR assay for ST171 in Enterobacter spp. The oldest ST171 identified from 2001 was carbapenem susceptible suggesting that this strain type later acquired plasmid mediated carbapenem resistance. Prevalence of ST171 tracks with the prevalence of carbapenem resistance with a peak observed in 2009 for both and a decrease in 2013 Disclosures: All authors: No reported disclosures.