Identification of two CUL7 variants in two Chinese families with 3‐M syndrome by whole‐exome sequencing. Issue 7 (6th March 2020)

• Record Type: Journal Article
• Authors: Hu, Li; Wang, Xike; Jin, Tingting; Han, Yuanyuan; Liu, Juan; Jiang, Minmin; Yan, Shujuan; Fu, Xiaoling; An, Bangquan; Huang, Shengwen
• Is Part Of: Journal of clinical laboratory analysis. Volume 34:Issue 7(2020)
• Page Start: n/a
• Page End: n/a
• Publication Date: 2020-03-06
• Subjects: 3‐M syndrome -- CUL7 -- homozygous variant -- short stature -- whole‐exome sequencing; Diagnosis, Laboratory -- Periodicals; Medical laboratory technology -- Periodicals; 616
• DOI: 10.1002/jcla.23265
• Languages: English
• ISSNs: 0887-8013

Abstract

Abstract: Background: 3‐M syndrome is a rare autosomal recessive disorder characterized by primordial growth retardation, large head circumference, characteristic facial features, and mild skeletal changes, which is associated with the exclusive variants in three genes, namely CUL7, OBSL1, and CCDC8 . Only a few 3‐M syndrome patients have been reported in Chinese population. Methods: Children with unexplained severe short stature, facial dysmorphism, and normal intelligence in two Chinese families and their relatives were enrolled. Trio‐whole‐exome sequencing (trio‐WES) and pathogenicity prediction analysis were conducted on the recruited patients. A conservative analysis of the mutant amino acid sequences and function prediction analysis of the wild‐type (WT) and mutant CUL7 protein were performed. Results: We identified a homozygous missense variant (NM_014780.4: c.4898C > T, p.Thr1633Met) in CUL7 gene in a 6‐month‐old female infant from a non‐consanguineous family, and a homozygous frameshift variant (NM_014780.4: c.3722_3749 dup GGCTGGCACAGCTGCAGCAATGCCTGCA, p. Val1252Glyfs*23) in CUL7 gene in two affected siblings from a consanguinity family. These two variants may affect the properties and structure of CUL7 protein. Conclusion: These two rare variants were observed in Chinese population for the first time and have not been reported in the literature. Our findings expand the variant spectrum of 3‐M syndrome in Chinese population and provide valuable insights into the early clinical manifestations and pathogenesis of 3‐M syndrome for pediatricians and endocrinologists.