336 Small RNA Sequencing of Glioblastoma Multiforme Extracellular Vesicles. (August 2016)
- Record Type:
- Journal Article
- Title:
- 336 Small RNA Sequencing of Glioblastoma Multiforme Extracellular Vesicles. (August 2016)
- Main Title:
- 336 Small RNA Sequencing of Glioblastoma Multiforme Extracellular Vesicles
- Authors:
- de Mooij, Tristan
McCutcheon, Brandon A.
Leontovich, Alexey A.
Parney, Ian F. - Abstract:
- Abstract : INTRODUCTION: Glioblastoma (GBM) subverts the immune system toward immunosuppression through transfer of oncogenic components, including noncoding RNAs, via extracellular vesicles (EVs). GBM-derived EVs are detectable in blood and cerebrospinal fluid (CSF) and may 1 day serve as liquid biopsies. METHODS: EVs of 5 adult GBM cell lines generated at our institution from primary GBMs were harvested after serum-free culture and purified via sequential centrifugation. RNA was collected using the miRNAeasy kit (Qiagen) and sequenced with Illumina HiSeq 2000. Data were analyzed using the OASIS-2.0 platform using HG38. MirTarBase and MirDB interrogated validated and predicted microRNA-gene interactions. RESULTS: MDS and hierarchical clustering demonstrated dBT165 as an outlier. Seven hundred twelve of 28 623 interrogated noncoding RNAs were found to be expressed, most of which were not yet associated with GBM EVs. Samples contained miRNAs, piRNAs, snoRNAs, snRNAs, and rRNAs. Hsa-miR-21-5p, hsa-let-7b-5p, hsa-miR-3182, hsa-miR-4448, hsa-let-7i-5p constituted highest overall expression. Hsa-miR-21-5p demonstrated a distinct pathophysiological role, even in hsa-miR-21-5p-low samples, through its unique target signature. Top genes targeted by all miRNAs per sample were highly conserved and specific for cell cycle, PI3K/Akt signaling, p 53 and Glioma-curated KEGG pathways. MirDeep2 predicted 4 robustly expressed novel microRNAs with mature sequences aguggggccacgagcugaga,Abstract : INTRODUCTION: Glioblastoma (GBM) subverts the immune system toward immunosuppression through transfer of oncogenic components, including noncoding RNAs, via extracellular vesicles (EVs). GBM-derived EVs are detectable in blood and cerebrospinal fluid (CSF) and may 1 day serve as liquid biopsies. METHODS: EVs of 5 adult GBM cell lines generated at our institution from primary GBMs were harvested after serum-free culture and purified via sequential centrifugation. RNA was collected using the miRNAeasy kit (Qiagen) and sequenced with Illumina HiSeq 2000. Data were analyzed using the OASIS-2.0 platform using HG38. MirTarBase and MirDB interrogated validated and predicted microRNA-gene interactions. RESULTS: MDS and hierarchical clustering demonstrated dBT165 as an outlier. Seven hundred twelve of 28 623 interrogated noncoding RNAs were found to be expressed, most of which were not yet associated with GBM EVs. Samples contained miRNAs, piRNAs, snoRNAs, snRNAs, and rRNAs. Hsa-miR-21-5p, hsa-let-7b-5p, hsa-miR-3182, hsa-miR-4448, hsa-let-7i-5p constituted highest overall expression. Hsa-miR-21-5p demonstrated a distinct pathophysiological role, even in hsa-miR-21-5p-low samples, through its unique target signature. Top genes targeted by all miRNAs per sample were highly conserved and specific for cell cycle, PI3K/Akt signaling, p 53 and Glioma-curated KEGG pathways. MirDeep2 predicted 4 robustly expressed novel microRNAs with mature sequences aguggggccacgagcugaga, uagugguuaguacccugccuug, acagauugagagcucuuuu, and auuucuguccaacuucug. Predicted gene targets of novel miRNAs closely overlapped those of validated miRNAs. Hsa-miR-5585-3p ( P = .04, fold-change: 2.8), hsa_piR_020365 ( P = .016, fold-change: 7, 17th highest overall expression) and hsa_piR_008624 ( P = .017, fold-change: 3.6) were predictive of <2 years survival. CONCLUSION: To our knowledge, this is the first report detailing small RNA sequencing of GBM EVs. We demonstrated the expression of a multitude of previously unassociated noncoding RNAs, including 4 novel miRNAs. Hsa-miR-5585-3p, hsa_piR_020365, and hsa_piR_008624 were associated with shorter survival. Identification of noncoding RNAs and gene/pathway silencing analyses are of paramount importance for development of diagnostic and prognostic tools, providing pathophysiological understanding, and, in the future, potentially direct decision making. … (more)
- Is Part Of:
- Clinical neurosurgery. Volume 63(2016)Supplement 1
- Journal:
- Clinical neurosurgery
- Issue:
- Volume 63(2016)Supplement 1
- Issue Display:
- Volume 63, Issue 1 (2016)
- Year:
- 2016
- Volume:
- 63
- Issue:
- 1
- Issue Sort Value:
- 2016-0063-0001-0000
- Page Start:
- Page End:
- Publication Date:
- 2016-08
- Subjects:
- Nervous system -- Surgery -- Congresses
Neurosurgery
Nervous system -- Surgery
Neurologie
Congresses
Conference papers and proceedings
617.48 - Journal URLs:
- https://www.cns.org/education/browse-type/clinical-neurosurgery ↗
http://www.cns.org/publications/clinical/ ↗ - DOI:
- 10.1227/01.neu.0000489825.15381.40 ↗
- Languages:
- English
- ISSNs:
- 0069-4827
- Deposit Type:
- Legaldeposit
- View Content:
- Available online (eLD content is only available in our Reading Rooms) ↗
- Physical Locations:
- British Library HMNTS - ELD Digital store
- Ingest File:
- 7828.xml