A new regulatory mechanism for bacterial lipoic acid synthesis. Issue 2 (22nd January 2015)

• Record Type: Journal Article
• Authors: Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
• Is Part Of: MicrobiologyOpen. Volume 4:Issue 2(2015:Apr.)
• Page Start: 282
• Page End: 300
• Publication Date: 2015-01-22
• Subjects: Microbiology -- Periodicals; 579
• DOI: 10.1002/mbo3.237
• Languages: English
• ISSNs: 2045-8827

Abstract

<abstract abstract-type="main" id="mbo3237-abs-0001"> <title>Abstract</title> <p>Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP‐dependent signaling is linked to lipoic acid synthesis in <italic>Shewanella</italic> species, the certain of unique marine‐borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in <italic>γ</italic>‐proteobacteria including <italic>Shewanella oneidensis</italic> was detected using Western blotting with rabbit anti‐lipoyl protein primary antibody. The two genes (<italic>lipB</italic> and <italic>lipA</italic>) encoding lipoic acid synthesis pathway were proved to be organized into an operon <italic>lipBA</italic> in <italic>Shewanella</italic>, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP‐recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP‐CRP protein with origins of both <italic>Escherichia coli</italic> and <italic>Shewanella</italic>. The native <italic>lipBA</italic> promoter of <italic>Shewanella</italic> was fused to a LacZ reporter gene to create a chromosome <italic>lipBA‐lacZ</italic> transcriptional fusion in <italic>E. coli</italic> and <italic>S. oneidensis</italic>, allowing us to directly assay its expression level by <italic>β</italic>‐galactosidase activity. As anticipated, the removal of <italic>E. coli crp</italic> gene gave above fourfold increment of <italic>lipBA</italic> promoter‐driven <italic>β</italic>‐gal expression. The similar scenario was confirmed by both the real‐time quantitative PCR and the LacZ transcriptional fusion in the <italic>crp</italic> mutant of <italic>Shewanella</italic>. Furthermore, the glucose effect on the <italic>lipBA</italic> expression of <italic>Shewanella</italic> was evaluated in the alternative microorganism <italic>E. coli</italic>. As anticipated, an addition of glucose into media effectively induces the transcriptional level of <italic>Shewanella lipBA</italic> in that the lowered cAMP level relieves the repression of <italic>lipBA</italic> by cAMP‐CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.</p> </abstract>